Invivogen
Menu

Omicron Variants (BA.4/BA.5) Spike Expression Vectors

Product Unit size Cat. code Docs. Qty. Price

pUNO1-SpikeV13

Spike gene from the Omicron Variants (BA.4/BA.5)

Show product

20 µg

p1-spike-v13
+-
$485

pUNO1-SpikeV13-dfur

Spike gene (inactivated furin site) from the Omicron Variants (BA.4/BA.5)

Show product

20 µg

p1-spike-v13-df
+-
$485

Optimized SARS-CoV-2 Spike gene (Omicron – BA.4/BA.5) for mammalian cell expression

pUNO1-SpikeV13 and pUNO1-SpikeV13-dfur plasmids have been specifically designed for the expression of the SARS-CoV-2 Spike (S) protein in mammalian cells with either a functional or inactivated furin (dfur) cleavage site. These plasmids encode the full-length Spike sequence from the Omicron BA.4 and BA.5 variants, which share the same Spike protein. This Spike gene is codon-optimized and the C‑terminal ER-retention signal has been removed for optimal cellular expression [1, 2].

 

Omicron Variant (BA.4/BA.5 lineages) Spike Expression vectors
Omicron Variant (BA.4/BA.5 lineages) Spike Expression vectors
for cell fusion and flow cytometry assays

Gene Description

These plasmids encode the Spike protein from the SARS-CoV-2 Omicron BA.4/BA.5 variants, first reported in South Africa in early 2022. They are classified as members of Clade 22A/22B (Nextstrain classification) and BA.4/BA.5 lineages (Pango classification). They are characterized by the presence of several mutations within the Spike coding region, of which, several are of concern [3,4].

  • S1 domain: T19I, deletion (Δ)L24-P26, A27S, ΔH69+V70, G142D, V213G, D614G, H655Y, N679K, P681H
  • RBD: G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H
  • S2 domain: N764K, D796Y, Q954H, N969K

Learn moreLearn more about SARS-CoV-2 Variants

 

The Spike protein contains a furin cleavage site that affects its cellular expression [4, in-house data]. Therefore, depending on your application InvivoGen offers:

  • pUNO1-SpikeV13: with a functional furin cleavage site and recommended for Spike/ACE2 cell fusion assays
  • pUNO1-SpikeV13-dfur: with an inactive furin (dfur) cleavage site for improved surface expression and detection (flow cytometry)

More details More details

 

General Plasmid Description

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal.  The codon-optimized ORF includes the native SARS-CoV-2 Spike signal sequence. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells (transient and stable transfection).

 

Applications

  • Spike-mediated cell fusion assays with pUNO1-SpikeV13
  • Cell surface detection by flow cytometry with pUNO1-SpikeV13-dfur
  • Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma

 

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/
4. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Back to the top

Specifications

pUNO1-SpikeV13

  • Origin: Omicron variant (BA.4/BA.5 lineages)
  • Sequence Reference:  EPI_ISL_11542604
  • Codon Optimized
  • ORF size: 3750 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

pUNO1-SpikeV13-dfur

  • Origin: Omicron variant (BA.4/BA.5 lineages)
  • Sequence Reference: EPI_ISL_11542604
  • Codon Optimized and R683/5A mutations
  • ORF size: 3750 bp
  • Sequencing primers:
    - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
    - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.
Back to the top

Contents

pUNO1-SpikeV13 and pUNO1-SpikeV13-dfur are provided as follows:

Please note: Each plasmid is sold separately. 

  • 20 μg of lyophilized DNA
  • 2 x 1 ml Blasticidin at 10 mg/ml

 

room temperature The product is shipped at room temperature.

store Lyophilized DNA should be stored at -20 °C.

stability Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Alert Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

AlertAvoid repeated freeze-thaw cycles.

Back to the top

Details

Furin cleavage site in the SARS-CoV-2 Spike protein

A furin cleavage sequence (RRxR) is found within a polybasic cleavage site (681-PRRSR/SVA-688) at the boundary between the S1 and S2 domains (S1/S2) of the Spike protein [1]. Furin is enriched in the Golgi apparatus, where it functions to cleave proteins into their 'mature/active forms'. Specifically, it is suggested that cleavage at this site by furin pre-primes the SARS-CoV-2 S protein during its production. This allows further processing by cell surface host proteases (e.g. TMPRSS2)  upon binding to ACE2, which ultimately facilitates viral-host membrane fusion [2,3].

► In a mammalian expression system (e.g. HEK293 cells), to maximize the surface expression of the S protein, the furin cleavage site in InvivoGen's pUNO1-SpikeV10-dfur has been inactivated (in-house data). The crucial recognition residues have been mutated (R683A and R685A) ensuring that the S protein is not cleaved by furin. 

Furthermore, the S protein possesses cell-cell fusogenic activity and has been shown to trigger large syncytia formation (multi-nucleated cells). Notably, overexpression of an uncleavable S protein (mutated/inactivated furin cleavage site) has been shown to not induce cell-cell fusion, suggesting that cleavage at the multibasic site is a requirement for syncytia formation [3].

► To study cell-cell fusion by the SARS-CoV-2 spike, InvivoGen offers the pUNO1-SpikeV11 plasmid. 

 

References:

1. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.
2. Johnson, B.A. et al. 2021. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature
3. Papa, G. et al. 2021. Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for infection and cell-cell fusion. PLoS Pathog 17, e1009246.

Back to the top

PRODUCT NOTIFICATION
Each SARS-CoV-2 variant is generally depicted as the phylogenetic root node of a variant clade, which comprises multiple genomic sequences. However, most, if not all genomic sequences in that clade share a list of defining mutations. InvivoGen provides one Spike consensus coding sequence for each variant, which can be downloaded in the product table above.

Customer Service
& Technical Support
Shopping cart is empty